Note:

(1) Make sure your email address is reachable, as your analysis results will be sent to you by email.

 

(2) Your analysis result will be in GFF3 format, compatible to the genome/reference file submitted. Sequence information can be extracted using other tools, like TBtools (https://github.com/CJ-Chen/TBtools/releases).

 

(3) The time of analysis will differ according to the workload, genome size, sequencing depth, etc., but we will do our utmost to service you. If you have any special request, please contact us via sRNAanno@gmail.com.

 

(4) Security Policy

We will keep high-confidential of your data and analysis results. We will not, on any circumstances, release any information of your analysis to the public, without your permission.

Your results will be integrated into sRNAanno database and become accessible to public on the following conditions: a) upon your permission; b) your work has been published in an academic journal; c) your results are accessible via a third source (not sRNAanno).

 

(5) Important

Submitted sRNA NGS data must be in collapsed read format. for example:

>1-1

ACCACTCTTCCAGCTACCACGAT

>2-9

ACCGAGCGGCGGGTAGAATCCTTTA

>3-580

ACCGAGCGGCGGGTAGAATCCTTTG

>4-2

ACCGAGCGGCGGGTAGAATCCTTTT

……

Note: 1st number: unique read id; 2nd number: read abudance. For example, “3-580” means “ACCGAGCGGCGGGTAGAATCCTTTG” is named 3 and its abundance is 580.

 

Below is an example on the preparation of sRNA NGS data for submission using Fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit/commandline.html).

@E00492:353:HNJGKCCXY:5:1101:6756:1942

TTANAAACAGTTCTGTGGTGCCGGAAAGATCGGAAGAGC

+

A<F#FJJJJAA-FFJFF7JJFJFJJJF-<-AJJJ<JAF-

@E00492:353:HNJGKCCXY:5:1101:10957:1942

AACNGTCTGTCGAAACTATCGATAAGATCGGAAGAGCAC

+

AAF#FAA-JJAJFFAAFJJF7FFAAF-F-AFFAAFFJJJ

……

 

a. convert fastq file to fasta file

fastq_to_fasta -v -r -i sRNA_reads.fastq -o sRNA_reads.fa

 

b. trim adaptor

fastx_clipper -v -c -l 15 -a NNNNNNNNNNNNNNNN -i sRNA_reads.fa -o sRNA_reads.trimmed.fa

Note: fastx_clipper is a part of FASTX toolkit. “NNNNNNNNNNNNNNNN” is adapter sequence provided by users.

 

c. collapse reads

fastx_collapser -i sRNA_reads.trimmed.fa -o sRNA_reads.mc.fa

Note: sRNA_read.mc.fa is the file used for submission.

 

Thank you for using our service of small RNA annotation. Enjoy!